Table 1

RA associations of the newly identified loci in a trans-ancestral genome-wide association meta-analysis

VariantChr:position*Nearest geneEA/NEAEast AsianEuropeanMeta-analysis p HET
FreqASN ORKOR ORJAP ORASN (95% CI)PASN FreqEUR OREUR (95% CI)PEUR ORMETA (95% CI)PMETA
rs67056282:74208362 DGUOK-AS1 T/C0.180.870.890.88 (0.84 to 0.92)2.1×10−8 0.0070.90 (0.79 to 1.03)0.120.88 (0.85 to 0.92)6.7×10−9 0.95
rs29183925:10704797 DAP T/C0.290.950.950.95 (0.91 to 0.98)3.9×10−3 0.320.93 (0.90 to 0.96)1.6×10−6 0.94 (0.91 to 0.96)4.6×10−8 0.89
rs66044211:64042997 BAD A/G0.080.820.860.84 (0.79 to 0.89)3.9×10−8 0.100.93 (0.89 to 0.96)2.0×10−4 0.90 (0.87 to 0.93)1.1×10−9 0.67
rs5957871711:68859848 TPCN2 Ins1†/C0.510.900.920.91 (0.88 to 0.94)4.3×10−8 0.86‡NANA0.91 (0.88 to 0.94)4.3×10−8 NA
rs1279570211:128156314 LOC107984408 A/G0.771.141.071.11 (1.06 to 1.15)5.8×10−7 0.181.07 (1.03 to 1.11)8.5×10−4 1.09 (1.06 to 1.12)4.1×10−9 0.89
rs496358112:24813281 LOC105369698 A/G0.751.091.091.09 (1.05 to 1.13)6.6×10−6 0.091.09 (1.03 to 1.14)1.4×10−3 1.09 (1.06 to 1.12)3.8×10−8 0.98
rs19989420615:91038883 IQGAP1 CT/C0.361.121.121.12 (1.08 to 1.16)1.5×10−10 0.19‡NANA1.12 (1.08 to 1.16)1.5×10−10 NA
rs149041927§16:23871206 PRKCB A/Ins2¶0.380.900.910.91 (0.88 to 0.94)2.2×10−8 0.44‡NANA0.91 (0.88 to 0.94)2.2×10−8 NA
rs1291832716:30626616 ZNF689 T/C0.101.061.121.09 (1.03 to 1.16)1.6×10−3 0.121.09 (1.05 to 1.13)3.9×10−6 1.09 (1.06 to 1.12)3.0×10−8 0.98
rs601118620:62484008 C20orf181 T/C0.380.870.920.90 (0.87 to 0.93)3.7×10−9 0.0350.90 (0.82 to 0.99)2.6×10−2 0.90 (0.87 to 0.93)3.2×10−10 0.99
rs3515688322:45746152 SMC1B A/AT0.521.121.081.10 (1.06 to 1.13)1.9×10−8 0.63NANA1.10 (1.06 to 1.13)1.9×10−8 NA
  • *Based on hg19.

  • †CGGCTAAGGGGAGAGAGCCCGGAAGCCACGCACACCGGCGCAAGGGGCGGATA.

  • ‡Frequency data were retrieved from European statistics in the 1000 Genomes Project phase III.

  • §or rs59279623.

  • ¶AAGGGAG.

  • Chr, chromosome; EA, effect allele; EUR, European; Freq, frequency of EA; JAP, Japanese; KOR, Korean; NEA, non-effect allele; PHET, p value from a Cochrane’s Q test for heterogeneity in effect sizes; RA, rheumatoid arthritis.