SubjectTRBV
 FDR W1:3†SIGAGNQPQ
agtatcggggcgggcaatcagccccag
 FDR W1:5†SVGAGNQPQ
agtgtgggggcaggcaatcagccccag
  • TCR repertoire analysis was undertaken in RA patients W1:1–5 and FDR W1:1–5. Productive single TRAV and TRBV clonotypes detected from two patients with RA and three FDRs are shown.

  • *Frequency reflects the frequency of the repeated TRAV or TRBV clonotype divided by the total number of tetramer+ cells with productive TRAV or TRBV sequence, for each individual.

  • †Nucleotide sequences encoding each of the public CDR3β amino acid sequences, which require a minimal number of N or P additions to be produced. Nucleotides attributed by the germline Vβ, Dβ and Jβ genes are shown in blue, red and green, respectively. N-additions are in black and P-additions in purple text. The nucleotides at the D–J junction encoding the same amino acid are underlined in each case.

  • FDR, first-degree relatives; RA, rheumatoid arthritis.