Table 1

 Sequences of primers and TaqMan MGB probes for each polymorphism assay

PolymorphismTaqMan MGB-probes (5′–3′)Primers (5′–3′)
F, forward primer; mut, mutant allele probe; R, reverse primer; wt, wild type allele probe.
R702Wwt: CCCTGCTCcGGCGCF: CTGGCTGAGTGCCAGACAT
mut: CCCTGCTCtGGCGCR: GGATGGAGTGGAAGTGCTTG
G908Rwt: CTCTGTTGCcCCAGAATF: CTGTTGACTCTTTTGGCCTTTTCAG
mut: TCTGTTGCgCCAGAATR: GCCACCTCAAGCTTGGTGAT
leu1007fsinsCwt:CTGCAGGCCCTTGAF: CAGGTTGTCCAATAACTGCATCAC
mut: CTGCAGGcCCCTTGR: CAGACTTCCAGGATGGTGTCATT
HCR-325wt: GGTCcGGCTCCTF: CAGCAGGCTGAGGTGATCGT
mut: AGGTCtGGCTCCTGR: CCTGGGCCTCTAGCCTCATC
HCR-2327wt: CTCCAGCTcCAATCF: CCTGAGTGAAGCCATTTCCAA
mut: TGCTCCAGCTgCAAR: CTCCAACTGTCAGCTTAGC