DNA and cDNA amplification of MEFV: primer sequences and conditions for the polymerase chain reaction
| Amplified DNA or cDNA sequence | Name and sequence of primers | Primer positions* | PCR product | PCR conditions† |
|---|---|---|---|---|
| *The nucleotide position corresponds to the DNA and cDNA of MEFV accession sequences AF 111163 and AF 018080, respectively. | ||||
| †All reactions were carried out in 50 μl volume using 2.5 units of platinum Taq DNA polymerase (Gibco), 50 pmol of each primer, 200 mmol of each deoxyribonucleotide triphosphate, and 1.5 mmol of MgCl2. | ||||
| ‡10% DMSO was added in the reaction mixture. | ||||
| §T2U, 10T7U, T39U, and SP6MEFV2, MEFVSP6, SP39L primers have at the 5′ end the T7 and SP6 promoter sequences, respectively (T7: 5′ TAATACGACTCACTATAGGG 3′ and SP6: 5′ ATTTAGGTGACACTATAGGA 3′). | ||||
| ¶Nested PCR products were used for NIRCA analysis. | ||||
| bp, base pairs; NIRCA, non-isotopic RNase cleavage assay; PCR, polymerase chain reaction. | ||||
| DNA amplification EXON 2 | M2U 5′AACTTTAATATCCAAGGGGATTC 3′ | 2710–2732 | 771 bp | Primary PCR: ‡Denaturation at 94°C for 8 min followed by 37 cycles of denaturation at 94°C for 80 s, annealing at 58°C for 60 s, and extension at 72°C for 60 s |
| M2L 5′ TTCTCTGCAGCCGATATAAAGTA 3′ | 3458–3480 | |||
| T2U§ 5′ CTCTCCTCTGCCCTGAA 3′ | 2734–2750 | 745 bp | Nested PCR: ‡Denaturation at 94°C for 8 min followed by 37 cycles of denaturation at 94°C for 80 s, annealing at 60°C for 60 s, and extension at 72°C for 60 s. ¶For nested PCR, 1–2 μl of primary product was used as template | |
| SP6MEFV2§ 5′ GGTGACCGAATGTTCTGG 3′ | 3421–3438 | |||
| DNA amplification EXON | 10U 5′ GATTGGCGCTCAGGCACAT 3′ | 13709–13727 | 880 bp | Primary PCR: Denaturation at 94°C for 3 min followed by 25 cycles of denaturation at 94°C for 60 s, annealing at 59°C for 60 s, and extension at 72°C for 60 s |
| 10L 5′ GGCTCCGTGGGCACAGTAAC 3′ | 14569–14588 | |||
| 10T7U§ 5′ TGTGCTCTCCCCTACCA 3′ | 13777–13793 | 797 bp | Nested PCR: Denaturation at 94°C for 3 min followed by 23 cycles of denaturation at 94°C for 60 s, annealing at 59°C for 60 s, and extension at 72°C for 60 s. ¶For nested PCR, 0.5–2 μl of primary product was used as template | |
| MEFVSP6§ 5′ CACCTAGTCGGCATTC 3′ | 14517–14533 | |||
| cDNA amplification EXONS 3 to 9 | 39U 5′ AAAAGACAGCTGCGAATCTG 3′ | c835–c854 | 1091 bp | Primary PCR: Denaturation at 94°C for 3 min followed by 35 cycles of denaturation at 94°C for 80 s, annealing at 60°C for 80 s, and extension at 72°C for 80 s; 4 μl of generated cDNA was used as template |
| 39L 5′ CCTCTCCCATTTGTTTCC 3′ | c1907–c1925 | |||
| T39U§ 5′ AGCTGCGAATCTGGAC 3′ | c842–c857 | 1078 bp | Nested PCR: Denaturation at 94°C for 3 min followed by 35 cycles of denaturation at 94°C for 80 s, annealing at 60°C for 80 s, and extension at 72°C for 80 s; ¶1 μl of primary product was used as template | |
| SP39L§ 5′ AAGATGAGGTTGGGGTAA 3′ | c1862–c1879 | |||