rss
Ann Rheum Dis 68:1775-1780 doi:10.1136/ard.2008.099309
  • Basic and translational research
  • Extended report

Contribution of Fcγ receptor IIIA gene 158V/F polymorphism and copy number variation to the risk of ACPA-positive rheumatoid arthritis

  1. M M Thabet1,2,
  2. T W J Huizinga1,
  3. R B Marques1,
  4. G Stoeken-Rijsbergen1,
  5. A M Bakker1,
  6. F A Kurreeman1,
  7. S J White3,
  8. R E M Toes1,
  9. A H M van der Helm-van Mil1
  1. 1
    Department of Rheumatology, Leiden University Medical Centre, Leiden, the Netherlands
  2. 2
    Department of Internal Medicine, Assiut University Hospital, Assiut, Egypt
  3. 3
    Molecular Development, Murdoch Childrens Research Institute, Royal Children’s Hospital, Melbourne, Australia
  1. Correspondence to Dr M M Thabet, Department of Rheumatology, Leiden University Medical Centre, PO Box 9600, 2300 RC Leiden, The Netherlands; m.thabet{at}lumc.nl
  • Accepted 29 October 2008
  • Published Online First 19 November 2008

Abstract

Background: Fcγ receptors (FcγRs) are potent immune modulators. FcγR genes encompass a complex region, polymorphic by both single nucleotide polymorphisms (SNPs) and copy number variation (CNV). The heterogeneity of rheumatoid arthritis (RA) combined with the genetic complexity of FcγR genes may be the cause of inconsistent findings in previous RA studies on FcγR SNPs. There is increasing evidence that anti-citrullinated peptide antibody (ACPA)-positive RA and ACPA-negative RA have a different genetic background.

Objective: To investigate whether FcγRIIIA 158V/F SNP associates differently with ACPA-positive and ACPA-negative RA and to assess if the FcγRIIIA gene CNV affects the association of the FcγRIIIA 158V/F SNP with RA and whether the FcγRIIIA gene CNV confers risk for RA.

Methods: 945 patients with RA and 388 healthy controls, all Dutch-Caucasians, were included in the study. FcγRIIIA 158V/F SNP was genotyped using Sequenom. CNV of the FcγRIIIA gene was determined in 456 patients with RA and 285 controls using multiplex ligation-dependent probe amplification. Associations between genotypes and RA were analysed, stratifying for the presence/absence of ACPA and CNV.

Results: In all patients with RA the FcγRIIIA 158V/F SNP was not associated with RA. In ACPA-positive RA (n = 358), the VV genotype was more prevalent in cases than in controls (18.4% vs 13.2%, OR = 1.5, p = 0.05). After stratification for CNV the VV genotype was associated with RA in general (n = 426) (OR = 1.6, 95% CI 0.97 to 2.6, p = 0.05) and with ACPA-positive RA (n = 135) (OR = 2.1, 95% CI 1.2 to 3.8, p = 0.009) but not with ACPA-negative RA. The distribution of CNV was not significantly different between patients with RA and controls.

Conclusion: The FcγRIIIA 158 VV genotype confers risk for ACPA-positive RA; this association increased slightly after correction for CNV of the FcγRIIIA gene. CNV itself is not associated with RA susceptibility.

Rheumatoid arthritis (RA) is a systemic autoimmune disease for which the aetiology and pathogenesis remain largely unclear. One of the characteristic features of some patients with RA is the expression of autoantibodies such as rheumatoid factors and anti-citrullinated peptide antibodies (ACPA).1 Multiple genetic risk factors have been unequivocally shown to predispose for ACPA-positive RA but not for ACPA-negative RA, like HLA shared epitope,2 PTPN223 and recently, TRAF-C5.4 Also the results of HLA-association studies and genome-wide single nucleotide polymorphism (SNP) scans showed that ACPA-positive RA has a different genetic background than ACPA-negative disease.5 6 7 This emphasises the need to systemically study genetic risk factors in ACPA-positive and ACPA-negative RA separately.

The Fcγ receptors (FcγRs) play a crucial role in immunity by linking the IgG antibody-mediated responses with cellular effector and regulatory functions.8 FcγRIIIA is expressed by natural killer (NK) cells, macrophages9 and a subset of T lymphocytes.10 Additionally, this intermediate-affinity FcγR is believed to have a pivotal role in the clearance of immune complexes.11

These receptors are encoded by genes clustered on the long arm of chromosome 1 (1q21–q24) in a complex region showing extensive nucleotide sequence homology that resulted from duplication and recombination events which occurred in this cluster during the evolution.12 In addition, copy number variation (CNV) has been shown to be present in this region in several large-scale, whole-genome studies and focused studies.13 14 15 16 The presence of common CNVs can cause false SNP genotyping results. Figure 1 summarises the possible effects of CNV on SNP genotyping. A higher copy number may falsely enrich the heterozygotes, while the presence of a lower copy number (a single copy) may falsely enrich the homozygotes (hemizygosity as one allele is absent). The subsequent skewing of genotypes may lead them to fail the Hardy–Weinberg equation (HWE) and may blur the association of the studied SNPs with disease susceptibility. It may also limit the ability of the genome-wide SNP association studies to detect disease-associated SNPs in regions with CNV.17 Such genetic complexity renders successful genotyping of different SNPs in that region using classical methods notoriously difficult.

Figure 1

Possible effect of copy number variation (CNV) on single nucleotide polymorphism (SNP) genotyping. This figure illustrates how the presence of CNV can cause false SNP genotyping results. A high copy number falsely enriches the heterozygotes, while the presence of low copy number falsely enriches the homozygotes. In this figure the use of F and V characters was only for illustration purpose but this kind of erroneous genotyping result can occur in every genetic region that harbours both SNPs and CNV.

The presence of such a genetic complexity in the FcγR region, combined with the heterogeneity of RA, might be the cause of inconsistent findings in previous studies on FcγR SNPs in relation to RA. In particular, the functionally relevant, FcγRIIIA 158V/F polymorphism (rs396991) had been extensively studied in RA case–control studies, disclosing remarkably contradictory results. The 158V allele was found to be associated with RA susceptibility in many studies,18 19 20 21 in another study the 158F allele was associated with RA,22 whereas in other studies no association with RA was observed.23 24 25 26 27 28 These contradictory results may, in part, be caused by methodological difficulties due to the extreme homology to FcγRIIIB29 but difficulties in genotyping due to the presence of CNV as well as the heterogeneity of RA regarding the ACPA status are likely causes that have never been examined.

Given the important role of FcγRIIIA in autoimmunity, we specifically wanted to study the association of FcγRIIIA 158V/F polymorphism with ACPA-positive RA. The ACPA-negative RA group was also studied. Additionally, we investigated whether the presence of CNV of the FcγRIIIA gene has any effect on the association between the FcγRIIIA 158V/F SNP and RA and also if the presence of CNV of the FcγRIIIA gene itself associates with susceptibility to RA.

Patients and methods

Subjects

Nine hundred and forty-five Dutch Caucasian patients with RA, all of whom fulfilled the American College of Rheumatology classification criteria for RA were studied and have been described elsewhere.30 31 32 Controls were 388 unrelated Dutch Caucasians with no history of RA.33 For both patients and controls informed written consent according to the Declaration of Helsinki was obtained. The Commissie Medische Ethiek, the Leiden institutional review board, approved all protocols.

ACPA status was available for 619 patients, and was positive in 58.8% (n = 364) of cases. rheumatoid factor status was available for 899 patients, and was positive in 64.8% (n = 583) of cases. Shared epitope status was available for 610 patients and was positive in 70.2% (n = 428) of cases. Serum ACPA was determined by ELISA (CCP2, Immunoscan RA Mark 2, Euro-Diagnostica, Arnhem, the Netherlands and Axis-Shield, Dundee, UK) and the cut-off level for ACPA positivity was set at 25 arbitrary units, according to the manufacturer’s instructions.

Genotyping

FcγRIIIA 158V/F (rs396991) was genotyped using the MassArray matrix-assisted laser desorption ionisation-time-of-flight mass spectrometry, according to the protocols recommended by the manufacturer (Sequenom, San Diego, California, USA). The sequences of PCR primers used in the assay were (ACGTTGGATGTTCACAGTCTCTGAAGACAC) and (ACGTTGGATGAAGCCACACTCAAAGACAGC) and the sequence of the extension primer was (ggagACTTCTGCAGGGGGCTT). SpectroCaller software supplied by the manufacturer was used to automatically call the genotypes. All doubtful calls were rechecked, and after manually evaluating their spectra, they were either accepted or recalled, and if still doubtful the calls were rejected. Ten per cent of samples were genotyped in duplo. The error rate of genotyping was 0%.

CNV

The CNV status of the FcγRIIIA gene was assessed using multiplex ligation-dependent probe amplification (MLPA); which is a sensitive method for copy number quantification.34 MLPA probe design and assay were performed as described by White et al.35 The MLPA probe sequences used were (GACTCCCACCTTGAATCTCATCCCCAGGGTCTCA) and (CTGTCCCATTCTTGGTGCTGGGTGGATCTAAATCCAGG). Because a relatively large amount of DNA is needed for MLPA (in our experiment 125 ng DNA for each sample to get accurate and reliable results), enough DNA was not available from all the patients with RA and controls genotyped for the FcγRIIIA 158V/F SNP. Additionally, not all the DNA samples used for SNP genotyping were extracted using the same method. According to the manufacturer protocols, the use of DNA samples extracted using different methods may influence the MLPA results. The presence of remnants of phenol in phenol-extracted DNA can inhibit MLPA PCR and impede ligase enzyme activity, and the use of old magnetic particles in automated DNA extraction devices may result in incomplete sample denaturation, subsequently influencing MLPA results and rendering them incomparable. Therefore DNA samples that were extracted using phenol were not used for MLPA. Consequently, the MLPA was performed on 456 patients with RA and 285 controls for whom we had enough DNA extracted using the same method.

Statistical analysis

The χ2 test with two degrees of freedom (Epi Info v6, CDC, Atlanta, Georgia, USA) was used to compare the relation between genotypes and ACPA-positive and ACPA-negative RA. The MLPA results were analysed as described by White et al.36 The height of each probe-specific peak was divided by the sum of three control peaks to give a ratio. The median ratio for FcγRIIIA across all samples within an assay was calculated and used to normalise the ratios around a value of 1. The normalised ratio for each subject was calculated and plotted in a scatter plot (fig 2). Subgroups corresponding to different FcγRIIIA gene copy numbers were defined by eye and confirmed by cluster analysis (using R statistical software, version 2.5.0), and are delineated by vertical dotted lines. To minimise the possibility of the mis-genotyping of FcγRIIIA 158V/F polymorphism that can be caused by CNV (fig 1), we performed the analysis on the subgroup of subjects with no CNV (the middle cluster in fig 2), thus excluding genotypes from samples with either low or high copy number (the first and the third clusters in fig 2). p Values <0.05 were considered statistically significant.

Figure 2

Copy number variation (CNV) of the FcγRIIIA gene. Cluster 1 represent samples with a low copy number and cluster 3 represents samples with a high copy number of FcγRIIIA compared with cluster 2 that represents samples without CNV of the FcγRIIIA gene. MLPA, multiplex ligation-dependent probe amplification.

Results

This study included 945 patients with RA and 388 healthy controls. Table 1 shows the genotype frequencies of the FcγRIIIA 158V/F SNP in patients with RA and controls. The genotype frequencies of FcγRIIIA 158V/F polymorphism (rs396991) were in accordance with HWE (p value is 0.6 in cases and 0.4 in controls). No statistically significant differences in the genotype or allele frequencies between patients with RA and controls were seen. However, after stratifying for ACPA status, the 158VV genotype was more frequent in ACPA-positive patients with RA than in controls (p = 0.05, OR = 1.5, 95% CI 0.99 to 2.27). Similarly, the frequency of the 158V allele in the ACPA-positive RA group (n = 358) was higher than in controls (p = 0.034, OR = 1.3, 95% CI 1.01 to 1.55). No differences were found in the ACPA-negative group (n = 252) (table 1).

Table 1

Comparison of the FcγRIIIA 158V/F genotype and allele frequencies in all patients with rheumatoid arthritis (RA) and controls

The FcγRIIIA gene shows CNV in 6.6% of patients with RA and in 9.5% of controls (table 2). Since the presence of CNV might lead to skewing of the genotype frequencies by causing genotyping errors (fig 1), we assessed whether CNV of the FcγRIIIA gene has an influence on the association of FcγRIIIA 158V/F polymorphism and RA. Therefore, we determined the association between FcγRIIIA 158V/F and ACPA-positive and ACPA-negative RA in subjects with no CNV of the FcγRIIIA gene. Genotypes from subjects with no CNV were selected (cluster 2 in fig 2), thus excluding samples that showed either low or high copy number of FcγRIIIA gene (clusters 1 and 3, respectively in fig 2). Without stratifying for ACPA, the 158VV genotype was significantly more frequent in patients with RA than in controls (17.2 vs 11.7, respectively, p = 0.05, OR = 1.6, 95% CI 0.97 to 2.6), but the frequency of the 158V allele was not significantly higher in patients with RA than in controls. Subsequently, stratifying for ACPA status showed an increased risk of RA as the 158VV genotype was more frequent in the ACPA-positive patients with RA than in controls (21.5 vs 11.7, respectively, p = 0.009, OR = 2.1, 95% CI 1.2 to 3.8) and the presence of the 158V allele was also associated with ACPA-positive RA (p = 0.039, OR = 1.4, 95% CI 1 to 1.9). No association was found in the ACPA-negative group (table 3). Comparing the data without and with stratification for CNV (table 1 and 3, respectively) shows that almost similar results were observed for the effect of the 158V allele on the risk of ACPA-positive RA. In contrast, the odds ratio for the effect of the 158VV genotype on the risk of RA became higher after correcting for the presence of CNV, although the confidence intervals overlapped.

Table 2

Copy number variation of the FcγRIIIA gene

Table 3

Comparison of the FcγRIIIA 158V/F genotype and allele frequencies in patients with rheumatoid arthritis (RA) and controls with no copy number variation

All the subjects identified as having low copy number (a single copy) were genotyped as homozygous for either the 158V or the 158F alleles (as suggested by fig 1).

The third aim of this study was to investigate whether the difference in FcγRIIIA gene copy number confers risk for RA. The distribution of CNV was not significantly different between patients and controls with and without stratifying for ACPA status (table 2).

Discussion

In this study we investigated the association between the FcγRIIIA 158V/F SNP and ACPA-positive as well as ACPA-negative RA and explored the effect of CNV of the FcγRIIIA gene on the association of FcγRIIIA 158V/F SNP with RA. We observed that the association between the FcγRIIIA 158V allele and RA is confined to the ACPA-positive group. In addition, after correction for the effect of the presence of CNV on genotypes, the strength of the association was slightly increased. To our knowledge, this is the first study to consider the effect of disease heterogeneity (presence/absence of ACPA) and genetic heterogeneity (effect of CNV on SNP genotyping) on the association between FcγRIIIA 158V/F polymorphism and RA.

The FcγRIIIA is expressed on NK cells and on macrophages, the expression by macrophages being limited to only a few tissues which correlate with the sites of pathology seen in patients with RA (synovium, dermis under stress, lungs, pericardium and liver).37 The FcγRIIIA expression on NK cells and the number of FcγRIIIA-IgG binding sites per NK cell correlate with the antibody-dependent, cell-mediated cytotoxicity function of these cells.38 The presence of the FcγRIIIA 158V/F SNP, which is a T to G substitution at nucleotide 559 in the FcγRIIIA gene that results in a switch from phenylalanine to valine at amino acid position 158 in the immunoglobulin binding domain, has functional consequences. It was shown that this 158V/F SNP affects the binding affinity of FcγRs to IgG: the 158V allele is associated with higher NK cell IgG binding affinity than the 158F allele, with a gene-dosage effect.39 In addition, IgG stimulation of NK cells from 158VV subjects resulted in higher Ca2+ influx, higher concentrations of interleukin 2 (IL2) receptor (CD25) expression and reduced survival of NK cells after activation-induced cell death in comparison with 158FV or 158FF subjects.40

So far, the results of the published studies concerning the FcγRIIIA 158V/F SNP in RA vary markedly. They differ in the presence or absence of its association with RA as well as in the allele frequencies within similar ethnic populations. Table 4 summarises the results of these studies. In our study, the genotype and minor allele frequency in controls and patients with RA were almost identical to those previously reported in Dutch Caucasians.23

Table 4

The FcγRIIIA 158V/F polymorphism association with rheumatoid arthritis (RA) in different studies

It was suggested that these contradictory results originated from methodological difficulties, owing to the extreme homology of the FcγRIIIA to FcγRIIIB gene that might lead to falsely detecting an FcγRIIIB sequence as the FcγRIIIA 158V variant, leading to false overpresentation of the 158V allele.29 As indicated, there are two additional explanations that may have been overlooked. First, we now provide evidence that the FcγRIIIA 158VV genotype associates with ACPA-positive subset of RA. A previous meta-analysis23 showed an odds ratio of 1.3 for the FcγRIIIA 158VV genotype to increase the risk of RA; the percentage of ACPA-positive patients with RA in those studies is unknown. Our data suggest the need for an additional meta-analysis in ACPA-positive patients with RA specifically. Second, the presence of CNV in this gene cluster may previously have led to skewing of the genotype frequencies, subsequently affecting disease associations. Since the frequency of CNV has been reported to vary significantly in different ethnic populations,36 CNV may be another cause of the different allele frequencies of FcγRIIIA 158V/F polymorphism and different associations with RA seen in different populations.

In our study, after controlling for the FcγRIIIA gene copy number, the association between patients with RA in general (without considering the ACPA status) and presence of the 158VV genotype became borderline significant (p = 0.05, OR = 1.6, 95% CI 0.97 to 2.6 vs p = 0.2, OR = 1.3, 95% CI 0.87 to 1.78 without controlling for the CNV). Similarly in the ACPA-positive group before correcting for the presence of CNV, the presence of the 158VV genotype was associated with RA susceptibility with a borderline significant p value (0.05) and an odds ratio of 1.5 (95% CI 0.99 to 2.27). In the ACPA-positive group without CNV this association had an odds ratio of 2.1 (95% CI 1.2 to 3.8). Although these confidence intervals are overlapping and although the presence of CNV of FcγRIIIA did not significantly change the genotype frequencies (probably because the frequency of CNV was relatively low in comparison with the 158V allele), correction for the presence of CNV affected the association between the 158VV genotype and RA. In our opinion, these data underline the need to take the CNV into consideration while performing analysis on SNPs.

The CNV of other FcγRs genes has been shown to associate with susceptibility to several autoimmune diseases such as lupus nephritis16 and idiopathic thrombocytopenic purpura.41 This study evaluated CNV in the FcγRIIIA gene. We confirmed the presence of CNV in the FcγRIIIA gene with a frequency of 9.5% in healthy controls and 6.6% in patients with RA. A comparable frequency of CNV was recently reported in another study with a smaller sample size (116 patients with idiopathic thrombocytopenic purpura and 100 healthy controls).41 We did not find an association between CNV of the FcγRIIIA gene and susceptibility to RA, although, because of the low frequency of CNV in this gene, we were underpowered to conclude formally that the CNV of the FcγRIIIA gene is not associated with RA susceptibility.

In conclusion, the FcγRIIIA gene shows a CNV which was not differently distributed between patients with RA and healthy controls. The analysis of the association between the FcγRIIIA 158V/F polymorphism and RA, stratified for ACPA status and CNV of the FcγRIIIA gene, showed that the FcγRIIIA 158VV genotype confers risk for ACPA-positive RA. The fact that a SNP in the FcγRs gene associates with ACPA-positive RA points to the relevance of antibodies in the pathophysiology of ACPA-positive RA.

Acknowledgments

We are grateful to Dr P Slagboom from the Department of Molecular Epidemiology, Leiden University Medical Centre, Leiden, The Netherlands, as well as the CMSB and NWO for providing the opportunity to perform the genotypings.

Footnotes

  • Funding The work of AHMvdH-vM is supported by the Netherlands Organisation for Health Research and Development and the Dutch Arthritis Association.

  • Competing interests None.

  • Ethics approval Ethics committee approval from the Commissie Medische Ethiek, the Leiden institutional review board.

REFERENCES

Free sample This recent issue is free to all users to allow everyone the opportunity to see the full scope and typical content of ARD.
View free sample issue >>

Don't forget to sign up for content alerts so you keep up to date with all the articles as they are published.