rss
Ann Rheum Dis 2004;63:747-748 doi:10.1136/ard.2003.007138
  • Letter

Polyclonal immunoglobulins for intravenous use induce interleukin 10 release in vivo and in vitro

  1. R J Lories1,
  2. M Casteels-Van Daele2,
  3. J L Ceuppens3,
  4. S W Van Gool2,3
  1. 1Laboratory for Skeletal Development and Joint Disorders, Department of Rheumatology, University Hospitals Leuven, Katholieke Universiteit Leuven, Belgium
  2. 2Department of Paediatrics, University Hospitals Leuven, Katholieke Universiteit Leuven, Belgium
  3. 3Laboratory of Experimental Immunology, Department of Clinical Immunology, University Hospitals Leuven, Katholieke Universiteit Leuven, Belgium
  1. Correspondence to:
    Professor Dr S Van Gool
    Department of Paediatrics, University Hospitals Leuven, Herestraat 49, B-3000 Leuven, Belgium; Stefaan.Vangooluz.kuleuven.ac.be
  • Accepted 9 July 2003

Polyclonal intravenous immunoglobulins (IVIg) are increasingly used in clinical practice, not only as substitutive agents but also in the treatment of immunologically mediated diseases.1,2 How IVIg modulate the immune system is not yet clear, but several immunoregulatory mechanisms have been postulated.2 We studied the production of the immunosuppressive cytokine interleukin 10 (IL10)3 as a potential explanation for the beneficiary effects of IVIg in autoimmune diseases.

IL10 concentrations were measured in six patients: one patient (aged 19) with X-linked agammaglobulinaemia, two patients (aged 63 and 64) with common variable immunodeficiency, one patient (aged 15) with hyper IgM syndrome, two patients (aged 4) with IgG2 subclass deficiency. All patients or their parents gave informed consent. Blood was collected before and immediately after infusion of IVIg (Sandoglobulin; Novartis, Brussels, Belgium), and IL10 levels were measured with a sandwich enzyme linked immunosorbent assay (ELISA) technique (anti-IL10 Screening Line; Pharmingen, San Diego, CA). The serum IL10 levels were increased after infusion of IVIg in all six patients (Wilcoxon non-parametric test, p<0.01) (fig 1A). No IL10 was detected in the IVIg.

Venous blood from healthy volunteers was collected and diluted 1:2 with culture medium. Final cell concentration was 1×104 white blood cells/ml. Cell culture was performed with or without endotoxin (1 ng/ml) or IVIg (3 mg/ml) for 15 minutes to 24 hours. An increase in IL10 levels as early as 1 hour after incubation with IVIg was consistently seen in all experiments performed (fig 1B). IL10 levels reached their highest level after 4 hours and remained high over the next 4 days. The rapid increase in IL10 levels is remarkable because endotoxin induces IL10 only after 8 hours and induces levels comparable to IVIg only after 24 hours. Increases in IL10 were seen in all our experiments but varied in intensity between different donors.

We also studied the effect of IVIg on IL10 mRNA levels in peripheral blood mononuclear cells (PBMC) from healthy volunteers. 1×104 PBMC were stimulated with IVIg (3 mg/ml) in culture medium for 2 or 24 hours and IL10 mRNA content was determined using Taqman real time, quantitative, reverse transcriptase-polymerase chain reaction (Applied Biosystems, Lennik, Belgium; IL10 forward primer GTGATGCCCAAGCTGAGA, IL10 reverse primer CACGGCCTTGCTCTTGTTTT, IL10 probe CCAAGACCCAGACA-TCAAGGCGCA). Gene expression levels were normalised to the expression of the reference gene β-actin (ABI Prism Taqman Assay Reagents, Applied Biosystems). IVIg stimulation resulted in a mean 9.6-fold increase in IL10 mRNA levels after 24 hours, but not after 2 hours (data not shown). A rapid increase of IL10 protein levels in vivo has previously been reported after liver transplantation.5 Our data further corroborate the hypothesis that IL10 production is regulated by both transcriptional and post-transcriptional mechanisms.3

In blocking experiments, cells were preincubated for 30 minutes in the presence of different anti-FcγR antibodies6 (anti-FcγRI (197), anti-FcγRII (IV.3), and anti-FcγRIII (3G8), all from Medarex (Milpitas, CA)) at 10 ng/ml at 4°C. IL10 production was effectively inhibited by monoclonal antibodies (mAb) directed against the FcγRI and FcγRIII. These mAb did not stimulate IL10 production in controls. Anti-FcγRI was responsible for the strongest inhibition, followed by anti-FcγRIII. The combination of these mAbs was more effective in inhibiting IL10 production than either of the mAbs alone, showing that triggering of both receptors increases IL10 release independently. Remarkably, recent data suggest that immune complexes or sera from patients with systemic lupus erythematosus (SLE) trigger IL10 production from PBMC mainly through FcRII.4

IL10 is a potent anti-inflammatory cytokine regulating the production of monokines such as tumour necrosis factor α and IL1 as well as shifting T cell responses towards a Th2 profile. Therefore, increased IL10 production by IVIg may provide an explanation for some of the remarkable immune suppressive properties in inflammatory and autoimmune diseases such as dermatomyositis.7

Figure 1

(A) Serum concentrations of interleukin10 (IL10) are increased immediately after infusion of polyclonal immunoglobulins for intravenous use (IVIg) in immunodeficient patients; (B) IVIg rapidly and strongly increase IL10 production in whole blood in vitro (one of seven experiments shown); (C) anti-FcR antibodies can inhibit IVIg induced IL10 production (one of three experiments shown).

Acknowledgments

RJ Lories is the recipient of an “Aspirant” fellowship and SW Van Gool is a clinical research fellow of the Fund for Scientific Research, Flanders.

REFERENCES

Register for free content


Free sample
This recent issue is free to all users to allow everyone the opportunity to see the full scope and typical content of ARD.
View free sample issue >>

Free archive
The full back archive is now available for Annals of the Rheumatic Diseases. Institutional subscribers may access the entire archive as part of their subscription. Personal subscribers will also have access to all content when logged in. Non-subscribers who register have free access to all articles published before 2006, back to volume 1 issue 1.
Register to access the free archive >>

Don't forget to sign up for content alerts so you keep up to date with all the articles as they are published.

  • Latest Rheumatology Jobs

    Rheumatology Jobs