BASIC AND TRANSLATIONAL RESEARCH

Thymic function in juvenile idiopathic arthritis

A R Lorenzi, T A Morgan, A Anderson, J Catterall, A M Patterson, H E Foster, J D Isaacs

Musculoskeletal Research Group, Institute of Cellular Medicine, Newcastle University, Newcastle-upon-Tyne, UK

Professor J D Isaacs, Musculoskeletal Research Group, Institute of Cellular Medicine, Newcastle University, Newcastle-upon-Tyne NE2 4HH, UK; j.d.isaacs{at}ncl.ac.uk

Accepted 1 June 2008

ABSTRACT

TOP ABSTRACT PATIENTS AND METHODS RESULTS DISCUSSION ACKNOWLEDGMENTS REFERENCES

Objective: Thymic function declines exponentially with age. Impaired thymic function has been associated with autoimmune disease in adults but has never been formally assessed in childhood autoimmunity. Therefore, thymic function in children with the autoimmune disease juvenile idiopathic arthritis (JIA) was determined.

Methods: Thymic function was measured in 70 children and young adults with JIA (age range 2.1–30.8 (median 10.4)) and 110 healthy age-matched controls using four independent assays. T cell receptor excision circles (WBLogTREC/ml) and the proportion of CD4⁺ CD45RA⁺CD31⁺ T cells (representing recent thymic emigrants; %RTEs) were quantified and intrathymic proliferation measured by calculating the TREC/βTREC ratio. Lastly, regulatory T cells (T_Reg) of thymic origin (CD4⁺FOXP3⁺) were quantified in peripheral blood to assess the ability of the thymus in JIA to generate this T cell subset.

Results: Thymic function was equivalent by all four parameters in JIA when compared with the control population. Furthermore, there was no consistent effect of JIA subtype on thymic function, although intrathymic proliferation was higher in the small rheumatoid factor (RF)⁺ polyarticular group. There were no significant effects of disease-modifying antirheumatic drugs (DMARDs) or oral corticosteroids on thymic function, although those with the worst prognostic ILAR (International League of Associations for Rheumatology) subtypes were also those most likely to be on a DMARD.

Conclusions: It is demonstrated that children and young adults with JIA, unlike adults with autoimmune diseases, have thymic function that is comparable with that of healthy controls. The varied pathologies represented by the term "JIA" suggest this observation may not be disease specific and raises interesting questions about the aetiology of thymic impairment in adult autoimmunity.

The thymus plays a critical role in the development of normal immune tolerance.¹ As well as negatively selecting potentially autoreactive T cells, it also positively selects the naturally occurring regulatory T cell subset (T_Reg) (CD4⁺FOXP3⁺).² Cross-sectional studies have demonstrated impaired thymic function in several adult autoimmune diseases.^3–6 It remains unclear whether the thymic defect is primary or secondary, although single gene defects affecting thymic integrity can predispose to autoimmunity.^{7 8} In contrast to adults, thymic function has not been formally quantified in childhood autoimmunity such as juvenile idiopathic arthritis (JIA).

The normal thymus is largest in childhood and is well known to decline in size and function with increasing age.⁹ Whilst not normally of apparent consequence, this decline becomes important under circumstances where the T cell pool is depleted, such as in HIV-AIDS or during lympho-ablative treatments such as bone marrow transplant or stem cell transplantation (SCT). This (normal) decline in thymic function with ageing is thought to explain the slower and often less complete T cell reconstitution following SCT in adults when compared with that in children.^{10 11}

JIA describes a heterogeneous group of diseases¹² ranging in severity from severe polyarticular disease sometimes associated with systemic features, to more benign oligoarticular disease. The more severe JIA subtypes have a poor prognosis, with lack of response to intense immunosuppression in some cases.^{13 14} Autologous SCT has recently been shown to induce prolonged, drug-free remission in a proportion of such refractory patients.¹⁵

Measuring thymic function in humans is complicated by the lack of a specific phenotype for recent thymic emigrants (RTEs), although the surface profile CD4⁺CD45RA⁺CD31⁺ has been proposed as a potential marker.¹⁶ Rearrangement of the T cell receptor chain (TCR) gene results in the formation of an episome of DNA called a "T cell receptor excision circle" (TREC).¹⁷ TRECs are present only in thymically derived T cells and do not divide with cellular mitosis. When quantified per millilitre of whole blood, TRECs are widely accepted to be the optimal measurement of thymic function.¹⁸

In the current study we compare thymic function in children with JIA and healthy controls. By measuring TRECs, the proportion of CD4⁺CD45RA⁺CD31⁺ T cells and T_Reg in peripheral blood, and intrathymic T cell development using a novel assay, we demonstrate that thymic function is not compromised in JIA.

PATIENTS AND METHODS

TOP ABSTRACT PATIENTS AND METHODS RESULTS DISCUSSION ACKNOWLEDGMENTS REFERENCES

Following ethical approval and informed consent from the child and/or a parent or guardian, 9 ml blood samples were obtained from healthy control children undergoing simple surgical procedures. Samples from young adults were donated by healthy volunteers. Study subjects were consecutive attendees at the Newcastle Regional Paediatric Rheumatology Service in Newcastle. All were given a diagnosis of JIA classified according to the ILAR (International League of Associations for Rheumatology) classification by a consultant Paediatric Rheumatologist.¹² Samples from older patients were obtained at adolescent and young adult rheumatology clinics. Blood was collected into Vacuette EDTA K3 tubes (Greiner Bio-one, Kremsmünster, Austria).

DNA was extracted from 300 µl of whole blood using the Wizard Genomic DNA extraction kit (Promega, Madison, Wisconsin, USA) and stored at 4°C. Sample purity and quantity was determined by spectrophotometry (Nanodrop ND-100, Wilmington, Delaware, USA).

We have developed a method quantifying TRECs/ml in DNA extracted from 300 µl of whole blood¹⁹. Briefly, WBLogTREC/ml is determined from a simultaneously amplified standard curve (range 10⁷–10¹ TREC molecules) using quantitative real-time PCR (RQ-PCR), an ABI Prism 7900HT Sequence Detector System and SDS2.2 software (Applied Biosystems, Warrington, UK).

Reactions (25 µl) contained primers CACATCCCTTTCAACCATGCT and GCCAGCTGCAGGGTTTAGG both at 700 nM, 150 nM Taqman hydrolysis probe (6-FAM-ACACCTCTGGTTTTTGTAAAGGTGCCCACT-TAMRA), 12.5 µl of JumpStart Taq ReadyMix (Sigma, Poole, UK) and 200 ng of DNA. Thermal cycling conditions were 50°C for 2 min then 95°C for 10 min, then 40 cycles of 95°C for 15 s and 60°C for 1 min. Experimental samples were run in duplicate and averaged.

Intrathymic proliferation was measured using a modified version (to allow for use with SYBR Green) of the method published by Dion et al.²⁰ Ten TCRβ chain D_βJ_β rearrangements (βTRECs) and the TCR chain recJ rearrangement (TRECs) were quantified in separate, nested PCRs. A duplex first round reaction with primers for individual βTRECs and genomic CD3 was followed by individual RQ-PCRs. The CD3 copy number multiplied by 0.5 (since each cell contains two copies) allowed the βTREC frequency to be reported per 10⁵ cells.

First-round 25 µl PCRs contained 1x High Fidelity PCR buffer (Invitrogen, Paisley, UK), 0.2 mM each of dNTPs (Invitrogen), 1.5 mM MgCl₂ (Invitrogen), 1 U of Platinum Taq High Fidelity (Invitrogen), 500 nM of both primers (Sigma Genosys, UK) and 150 ng of target DNA. Initial denaturation was at 95°C for 10 min followed by 22 cycles of 95°C for 30 s and 72°C for 30 s. Second-round, 25 µl reactions contained 2x SybrGreen PCR Master Mix (TAKARA, Berkshire, UK), 400 nM of each primer (Sigma Genosys) and 10 µl of template. Thermal cycling conditions were 95°C for 10 s followed by 40 cycles of 95°C for 5 s and 60°C for 60 s.

A 70 µl aliquot of whole blood was incubated in the dark at room temperature for 15 min, with combinations of antibodies to surface antigens: CD31–PE (phycoerythrin), CD45RA–FITC (fluorescein isothiocyanate; Serotec, Oxford, UK) and CD4–PE–Cy5 (Beckton Dickinson, Oxford, UK). Stained samples were incubated with 1x FACS Lyse Solution (Beckton Dickinson) for 10 min and washed twice.

PBMCs were isolated according to a standard, sucrose density gradient (Lymphoprep) protocol and cryopreserved in 10% dimethylsulfoxide (DMSO) in fetal calf serum (FCS) at –80°C until use. Thawed cells were surface stained with CD4⁺–FITC and then FOXP3–APC (allophycocyanin) antibody (eBiosciences, Wembley, UK) according to the manufacturer’s instructions. Flow cytometry was performed using a FACScan and data were analysed using FloJOv6.1.2. Sample identities were blinded to the assessor.

Statistical analyses were performed using SPSS 11th edition software. Values for WBLogTREC/ml were initially log transformed to allow parameteric testing. Population distributions were tested for normality with a one-sample Kolmogorov–Smirnov test. Correlations for normally distributed data were tested for significance using Pearson’s correlation coefficient. Differences between groups were assessed by analysis of covariance (ANCOVA) where other covariates were present, unless otherwise stated. Bonferroni corrections were applied to correct for multiple comparisons. Results were considered significant when p0.05.

RESULTS

TOP ABSTRACT PATIENTS AND METHODS RESULTS DISCUSSION ACKNOWLEDGMENTS REFERENCES

WBLogTREC/ml was quantified in 70 patients with JIA and 110 healthy controls (HCs). Table 1 describes the cohort. One additional patient had DiGeorge syndrome (chromosome 22q11 deletion-associated syndrome with thymic hypoplasia/aplasia) and a co-existing inflammatory arthritis. Figure 1A shows that there was no significant difference in thymic function between the groups after adjusting for age and gender (see below). Negative correlations with age were detected for both groups (p<0.01). The patient with DiGeorge syndrome had markedly deficient thymic function as evidenced by a 1.5Log deficit in WBLogTREC/ml when compared with age-matched controls. There was no difference in thymic function when ILAR JIA subtypes were compared (fig 2A).

View larger version (23K): in this window | in a new window | PowerPoint for Teaching   Figure 1 Thymic function is not significantly different in children with juvenile idiopathic arthritis (JIA) (grey diamonds, dashed regression line) and healthy controls (HCs) (filled squares, solid regression line) when quantified using WBLogTREC/ml (T cell receptor excision circles) (A) and by the proportion of T cells with the phenotype CD4+CD31+CD45RA+ (%RTE (recent thymic emigrants)) (B). WBLogTREC/ml was significantly negatively correlated with age (r = –0.762; p<0.001 for controls and r = 0.625; p<0.001 in JIA) as was %RTE (r = –0.656; p<0.001 and r = 0.491; p<0.001 respectively). In a single patient with co-existent DiGeorge syndrome (grey triangle with dashed circle surround), TREC levels were markedly reduced, but %RTE was age appropriate. In both HCs (C) and the JIA group (D), females (grey diamonds, dashed regression lines) have greater thymic function than males (filled squares, solid regression line) using WBLogTREC/ml (p = 0.002 and p = 0.003 respectively).

 

View larger version (27K): in this window | in a new window | PowerPoint for Teaching   Figure 2 Thymic function does not significantly differ between International League of Associations for Rheumatology juvenile idiopathic arthritis (JIA) subtypes when measured using either WBLogTREC/ml (T cell receptor excision circles) (A) or %RTE (recent thymic emigrants) (p = NS) (B). Bars represent age-adjusted group means (SEM). Groups were compared using analysis of covariance with age as a covariate and multiple comparisons corrected for by performing a Bonferroni correction. PolyRF+ and PolyRF–, polyarticular rheumatoid factor positive and negative, respectively; PsA, psoriatic; Enth, enthesitis associated; Ext oligo, extended oligoarticular; Persis oligo, persistent oligoarticular).

 

View this table: in this window | in a new window   Table 1 Patient characteristics according to ILAR subtype

 

CD4⁺CD45RA⁺CD31⁺ T cells are TREC rich and have been proposed as the phenotype of RTEs in humans.¹⁶ The proportion of T cells with this phenotype (%RTEs) declined with age in patients with JIA (n = 50) and HCs (n = 77) (fig 1B), but there was no significant difference in age-adjusted mean %RTEs.

Since both WBLogTREC/ml and %CD4⁺CD45RA⁺CD31⁺ T

cells have been proposed as markers of thymic function, there should be a strong positive correlation between them, independently of disease status. Although the relationship was strong in HCs (r = 0.71; p<0.01), it was less robust in patients with JIA (0.45; p<0.01). There was no effect of ILAR subtype on %RTEs (fig 2B).

In our patient with DiGeorge syndrome, the %RTEs was normal despite a significantly reduced WBLogTREC/ml value (fig 1B), suggesting that CD4⁺CD45RA⁺CD31⁺ T cells may be capable of self-renewal in the absence of thymic replenishment.

In both mice and adult humans, females have a larger thymic output (as determined by TREC quantification and histological analysis of thymic volume) than age-matched males.^{21 22} Using the two assays described above, we confirmed higher age-adjusted thymic output in females, in both HCs and patients with JIA (fig 1C,D). The age-adjusted mean WBLogTREC/ml value for HC females (n = 51) was 5.039 and for males (n = 59) 4.985 (p = 0.002); in the JIA group, the comparable figures were 5.004 (n = 46) and 4.826 (n = 24), (p = 0.003).

Using %RTEs, a gender difference was again detected in HCs (age-adjusted mean %RTEs in females (n = 36) 52.9%, males (n = 41) 45.6% (p = 0.001) but not in the JIA group (data not shown).

Corticosteroids and some immunosuppressive treatments have been considered to inhibit thymic function,^23–25 and we therefore sought an effect in JIA. It should be noted that the majority of children taking DMARDs or oral corticosteroids had more severe disease, falling into the systemic-onset, polyarticular and extended oligoarticular subtypes (see table 1). However, when patients receiving these drugs were compared with those not receiving them and with healthy controls using WBLogTREC/ml, no evidence of a significant effect of DMARDs (when considered collectively (n = 31)) (4.874 vs 4.933 vs 4.985) (fig 3A) or corticosteroids (± DMARD) (n = 11) (4.818 vs 4.924 vs 4.985) was found (data not shown). There was, however, a trend toward lower WBLogTREC/ml values in patients with JIA on a DMARD (p = 0.061) and those taking steroids (± DMARD) (p = 0.07) when compared with HCs. There was no effect of taking methotrexate (MTX) on WBLogTREC/ml values (4.887) when compared with those not on MTX (4.917) and with HCs (4.985) (p = NS) although some patients not on MTX were taking an alternative DMARD (primarily antitumour necrosis factor (TNF)) (n = 8). Other treatment groups contained too few patients to exclude an independent effect. In contrast, after adjustment for age and gender, %RTEs was significantly higher in patients on oral corticosteroids (n = 8; 58.3%) than in those not on oral corticosteroids (n = 40; 47.0%; p = 0.013), and the comparison with HCs (n = 77) approached significance (49.8%; p = 0.067). There was no difference between those not on oral corticosteroids and HCs. There was no significant effect of DMARD use (fig 3B) or MTX specifically on %RTEs.

View larger version (12K): in this window | in a new window | PowerPoint for Teaching   Figure 3 There was no significant effect on thymic function when measured using WBLogTREC/ml (T cell receptor excision circles) (A) or %RTEs (recent thymic emigrants) (B) of being on a disease-modifying antirheumatic drug (DMARD). Bars represent age- and gender-adjusted group means (SEM). Groups were compared by analysis of covariance with a Bonferroni correction to adjust for multiple comparisons. Patients not on a DMARD were more likely to have persistent oligoarticular disease than those taking one; see table 1. There was a trend toward lower WBLogTREC/ml values in those taking a DMARD (p = 0.061) when compared with healthy controls (HCs). *Includes those taking only non-steroidal anti-inflammatory drugs or relying only on local joint injections for disease control. **DMARDs include antitumour necrosis factor agents and interleukin 1 receptor antagonist (IL1ra).

 

When the TCR chain gene rearranges, the locus encoding the TCR chain is excised in a conserved rearrangement, resulting in the formation of a TREC that can be identified in approximately 70% of emerging thymocytes. This rearrangement is the basis of most standard TREC assays, including our own WBLogTREC/ml assay.¹⁷ When the TCRβ chain gene is rearranged, no single rearrangement occurs, but there are only 13 potential D_βJ_β gene rearrangements.²⁶ Dion et al devised an assay that quantifies 10 of these 13 TREC-generating rearrangements, the sum of which provides an estimate of the frequency of T cells in peripheral blood that have rearranged their TCRβ chain gene (βTREC).²⁰ TCR chain rearrangement occurs after TCRβ chain rearrangement. Between these events a phase of thymocyte proliferation expands thymocytes with a rearranged TCRβ chain, providing a substrate for the subsequent generation of TCR diversity through chain/β chain pairing. The ratio between the numbers of T cells containing detectable TCRβ and TCR chain rearrangements (TREC:βTREC) therefore gives an indication of the number of divisions, which is a measure of intrathymic proliferation and overall thymic function.

We determined intrathymic function in patients with JIA and HCs. No difference was found when 19 children with JIA were compared with 19 HCs, and there was also no detectable effect of gender (data not shown). There were insufficient samples to seek an effect of corticosteroids or DMARDs. The effect of ILAR subclassification was assessed. There were no significant differences between the groups after post hoc testing, with the exception of all comparisons with the polyarticular RF⁺ group (n = 3) which (after the two groups where n = 1 were excluded) achieved statistical significance (fig 4A). The true significance of this result is difficult to assess because of small patient numbers, and was lost when we combined together the poor prognosis subtypes of systemic onset, polyarticular and extended oligoarticular JIA ("non-oligoarticular", n = 9) and compared with persistent oligoarticular JIA ("oligoarticular" n = 11), a classification previously used²⁷ (fig 4B).

View larger version (10K): in this window | in a new window | PowerPoint for Teaching   Figure 4 (A) The ratio between the numbers of T cells containing detectable T cell receptor β (TCRβ) and TCR chain rearrangements (TREC:βTREC) (y-axis) was compared between International League of Associations for Rheumatology subtypes using analysis of covariance with Bonferroni correction for multiple comparisons, with age and gender as covariates because of their effect on the TREC (T cell receptor excision circle) value. When the two subsets where n = 1 were excluded, the comparisons between the polyarticular rheumatoid factor (RF)+ group and the reminder were statistically significant (p<0.05)—although caution should be applied to the interpretation of this result given the small group numbers. Sys, systemic (n = 3); PRF+ and PRF–, polyarticular RF+/polyarticular RF– (n = 3 both groups); PsA, psoriatic (n = 1); ExO, extended oligoarticular (n = 1); PerO, persistent oligoarticular (n = 8). (B) When grouped into persistent oligoarticular disease and non-oligoarticular disease (see text), there were no significant differences between the groups. Boxes represent the interquartile ranges (IQR) and bars the group medians. Whiskers give the data range, with "" representing extreme values (>3 IQR from the box end). HC, healthy controls.

 

In the patient with DiGeorge syndrome, the TREC:βTREC ratio was 57 in comparison with the HC group median (352) and the JIA group median (628), reflecting the impaired structural environment of the DiGeorge thymus and its reduced capacity for thymocyte expansion. The βTREC value in this patient was comparable with JIA values 1.58 vs 5.38 (range 0.53–17.41), whereas the TREC value was significantly reduced, 91 vs 3002 (range 851–5065). This implies that thymocyte proliferation is impaired in DiGeorge syndrome in comparison with HCs and children with JIA.

Lastly, we quantified the proportion of CD4⁺ T cells with the regulatory phenotype CD4⁺FOXP3⁺ (T_Reg). There was no detectable difference overall between patients with JIA and HCs. When individual ILAR subtypes were compared, there was a weak but significant difference between the patients with systemic and persistent oligoarticular disease (p = 0.031) in a post hoc analysis, although sample sizes were again small (table 2). To strengthen our analysis by increasing group numbers, patients with "non-oligoarticular" disease (as above) were compared with patients with persistent oligoarticular disease. We found a significant increase in the proportion of T_Reg in the oligoarticular group (8.19% vs 6.481%; p = 0.044, Tukey HSD post hoc analysis), consistent with other reports. Unlike those reports, however, there was no difference from HCs. There was no effect of gender, age or DMARD use, although MTX use was more common in non-oligoarticular JIA (see table 1), potentially confounding the difference between disease subtypes.

View this table: in this window | in a new window   Table 2 Mean values for %CD4+FOXP3+ and 95% CI for the "non-oligarticular" group (comprising systemic, polyarticular RF+ and RF–, and extended oligoarticular ILAR categories), the persistent oligoarticular group and a healthy control group

 

DISCUSSION

TOP ABSTRACT PATIENTS AND METHODS RESULTS DISCUSSION ACKNOWLEDGMENTS REFERENCES

Our data demonstrate that, in children with JIA, thymic function is comparable with that of healthy control children. This conclusion is strengthened by our analysis of multiple aspects of thymic function, including intrathymic proliferation and "downstream" effects on RTEs and T_Reg. Consistent with previous reports, we have demonstrated greater thymic function in females²⁸ and an age-associated decline in healthy controls,²⁹ findings that persist in JIA. In a single patient with inflammatory arthritis and co-existent DiGeorge syndrome, we showed a dramatic reduction in thymic function, consistent with thymic hypo/aplasia and similar to the effect of partial thymectomy during paediatric cardiac surgery.³⁰ Although we have previously confirmed that consecutive recruitment of patients from our clinic population provides a group of patients with a typical case mix³¹ (table 1), the short recruitment period (4 months) may have biased our population toward those with more severe disease (since they are more likely to attend hospital).

When data were analysed according to ILAR disease subtype, a minority of comparisons reached statistical significance or demonstrated a trend in that direction. For example, there was a trend toward reduced thymic function for those on a DMARD (although since disease group and DMARD use co-segregate, this analysis is confounded by ILAR subtype), and steroid use was associated with an increase in the %RTEs. The TREC:βTREC ratio was increased in the ILAR polyarticular RF⁺ group, whilst the persistent oligoarticular group had a significantly higher proportion of T_Reg than the ILAR systemic disease group, consistent with previous reports. These isolated observations should be interpreted with caution due to the small group numbers, and they require further analysis in a larger study in order to determine their true significance.

T cells with the phenotype CD4⁺CD45RA⁺CD31⁺ have significantly higher TREC content per cell than unselected CD4⁺ T cells,¹⁶ confirming that this subset is enriched for true thymic emigrants. Furthermore, CD4⁺CD45RA⁺CD31⁺ T cell telomeres are longer and telomerase activity higher than in CD4⁺CD45RO⁺CD31⁺ T cells, suggesting a limited replicative history.³² This phenotype has been used to monitor thymic function longitudinally^33–35 and, although interindividual variation is high, values are stable longitudinally³⁵ (ARL and JDI, unpublished results). Thus, it was interesting to note that, despite an 1.5Log deficit in WBLogTREC/ml in a patient with DiGeorge syndrome, the proportion of CD4⁺CD45RA⁺CD31⁺ T cells was age appropriate. Furthermore, WBLogTREC/ml and %RTEs did not always correlate well, particularly in disease (lending support to the recent observation that CD4⁺CD45RA⁺CD31⁺ T cells can in part be maintained by peripheral homeostasis³⁶), and thus may represent a less useful measure of thymic function in this setting. Naïve T cells proliferate excessively in patients with rheumatoid arthritis (RA), possibly under cytokine stimulation.³⁷ A similar phenomenon in JIA would weaken the correlation between CD4⁺CD45RA⁺CD31⁺ T cells and WBLogTREC/ml, as we have shown here.

Regardless of its indication, adults fare less well than children following autologous SCT (ASCT).³⁸ In part this reflects an inverse relationship between age and CD4⁺ T cell reconstitution^{39 40} but, in autoimmunity, disease-related thymic compromise may exacerbate the distinction. For example, patients with RA remain lymphodepleted for years following ASCT,⁴¹ but disease usually relapses rapidly despite persisting lymphopenia. In contrast, patients with JIA reconstitute more rapidly and, moreover, thymically derived T_Reg may contribute to long-term remission of symptoms.⁴² Thus, measures aimed at reversing age-associated thymic atrophy (currently in clinical trial^{43 44}) could significantly improve the outcome of ASCT in adults with autoimmune diseases.

The normal thymus produces T cells that are self-tolerant, with a polyclonal TCR repertoire. Age-related thymic involution results in a proportionally greater decline in thymocytes with rearranged TCR genes than with TCRβ chain genes,²⁰ with potential implications for repertoire diversity,⁴⁵ and therefore the maintenance of self-tolerance, responses to neoantigens and tumour surveillance.⁴⁶ We determined a ratio that reflected the number of cellular divisions between these two events. The similarity between patients (when collectively considered) and controls suggests that this step in thymocyte development is intact in JIA. When individually considered, however, there was a significant increase in the ratio for the polyarticular RF⁺ patients. A single extreme value contributes to this effect, but the remaining two individual values were also greater than for all other subtypes (fig 4A), a consequence of both low βTREC and high TREC values (data not shown). The significant contribution of the TREC value to the ratio and the variance of this value in both patients with JIA and HCs (fig 1) should also be noted, and duplication of our results is required before further conclusions about this difference can be drawn. If confirmed, however, this result would suggest enhanced intrathymic proliferation in the JIA subtype that most closely resembles adult RA, in which there is evidence of impaired thymic function.³ TCR diversity and TRECs are positively correlated,⁴⁷ suggesting that the TCR repertoire in JIA is also likely to be maintained.

De Kleer et al distinguished two subsets of T_Reg in JIA peripheral blood following ASCT.⁴² Expansion of mature, non-depleted or grafted T_Reg in the lymphopenic environment was followed 6–8 months later by the appearance of T_Reg of recent thymic origin (which may have greater suppressive function than memory CD45RO⁺ T_Reg⁴⁸), together replenishing the depleted pretransplant T_Reg pool.⁴² Although we did not distinguish T_Reg subsets, we found a higher proportion of T_Reg in persistent oligoarticular disease than in non-oligoarticular disease although we could not confirm a difference between either group and HCs, possibly reflecting our use of FOXP3 to quantify T_Reg, rather than CD25^bright.⁴² We have previously shown that adults with self-limiting reactive arthritis have a higher proportion of T_Reg than adults with RA,⁴⁹ and murine studies have demonstrated that Foxp3⁺ T cells protect against autoimmune disease and inflammation in vivo.⁵⁰ Collectively, these data suggest that control of inflammatory disease may be associated with this subset of T cells. Indeed, all four patients with systemic JIA studied here had a very low proportion of T_Reg in peripheral blood. However, their otherwise normal thymic function suggests that their T_Reg deficit may reflect a failure of peripheral T_Reg homeostasis in progressive, chronic disease.

In conclusion, using a variety of measurements, we have demonstrated age-appropriate thymic function in patients with JIA. We found no clear influence of therapy on thymic function, although DMARD use was more common in patients with JIA with a poor prognosis and was associated with trends toward lower WBLogTREC/ml values. We also found similar T_Reg values in HCs and patients with JIA, although patients with JIA of the better prognosis subtype had higher values. Our findings differ from those in adult patients with autoimmune disease, in whom thymic dysfunction has been implicated as a possible aetiological factor.^3–6

ACKNOWLEDGMENTS

TOP ABSTRACT PATIENTS AND METHODS RESULTS DISCUSSION ACKNOWLEDGMENTS REFERENCES

We gratefully acknowledge D Douek and RP Sekaly for providing TREC standard constructs, and Mick Eltringham for considerable help with collection of study samples. This work was funded by an Arthritis Research Campaign Clinical Research Fellowship to ARL (Grant Reference L0547) and an Arthritis Research Campaign Integrated Clinical Arthritis Centre Grant (Grant Reference ICAC 16361).

FOOTNOTES

Competing interests: None.

Funding: This work was funded by a Clinical Research Fellowship (ARL) and a Studentship (TAM) from the Arthritis Research Campaign (UK)

Ethics approval: Ethical approval was obtained

Patient consent: Informed consent obtained was from each child and/or a parent or guardian.

Published Online First 14 July 2008

REFERENCES

TOP ABSTRACT PATIENTS AND METHODS RESULTS DISCUSSION ACKNOWLEDGMENTS REFERENCES

1. Miller JF. Discovering the origins of immunological competence. Annu Rev Immunol 1999;17:1–17.[CrossRef][Medline]
2. Sohn SJ, Thompson J, Winoto A. Apoptosis during negative selection of autoreactive thymocytes. Curr Opin Immunol 2007;19:510–5.[CrossRef][Medline]
3. Koetz K, Bryl E, Spickschen K, O'Fallon WM, Goronzy JJ, Weyand CM. T cell homeostasis in patients with rheumatoid arthritis. Proc Natl Acad Sci USA 2000;97:9203–8.[Abstract/Free Full Text]
4. Kayser C, Alberto FL, da Silva NP, Andrade LE. Decreased number of T cells bearing TCR rearrangement excision circles (TREC) in active recent onset systemic lupus erythematosus. Lupus 2004;13:906–11.[Abstract/Free Full Text]
5. Hug A, Korporal M, Schroder I, Haas J, Glatz K, Storch-Hagenlocher B, et al.. Thymic export function and T cell homeostasis in patients with relapsing remitting multiple sclerosis. J Immunol 2003;171:432–7.[Abstract/Free Full Text]
6. Sempowski G, Thomasch J, Gooding M, Hale L, Edwards L, Ciafaloni E, et al.. Effect of thymectomy on human peripheral blood T cell pools in myasthenia gravis. J Immunol 2001;166:2808–17.[Abstract/Free Full Text]
7. Nagamine K, Peterson P, Scott HS, Kudoh J, Minoshima S, Heino M, et al.. Positional cloning of the APECED gene. Nat Genet 1997;17:393–8.[CrossRef][Medline]
8. Bennett CL, Christie J, Ramsdell F, Brunkow ME, Ferguson PJ, Whitesell L, et al.. The immune dysregulation, polyendocrinopathy, enteropathy, X-linked syndrome (IPEX) is caused by mutations of FOXP3. Nat Genet 2001;27:20–1.[CrossRef][Medline]
9. Haynes BF, Sempowski GD, Wells AF, Hale LP. The human thymus during aging. Immunol Res 2000;22:253–61.[CrossRef][Medline]
10. Fallen PR, McGreavey L, Madrigal JA, Potter M, Ethell M, Prentice HG, et al.. Factors affecting reconstitution of the T cell compartment in allogeneic haematopoietic cell transplant recipients. Bone Marrow Transplant 2003;32:1001–14.[CrossRef][Medline]
11. Dumont-Girard F, Roux E, van Lier RA, Hale G, Helg C, Chapuis B, et al.. Reconstitution of the T-cell compartment after bone marrow transplantation: restoration of the repertoire by thymic emigrants. Blood 1998;92:4464–71.[Abstract/Free Full Text]
12. Petty RE, Southwood TR, Baum J, Bhettay E, Glass DN, Manners P, et al.. Revision of the proposed classification criteria for juvenile idiopathic arthritis: Durban, 1997. J Rheumatol 1998;25:1991–4.[Medline]
13. Ravelli A, Martini A. Juvenile idiopathic arthritis. Lancet 2007;369:767–78.[CrossRef][Medline]
14. Wulffraat NM, de Kleer IM, Prakken B. Refractory juvenile idiopathic arthritis: using autologous stem cell transplantation as a treatment strategy. Expert Rev Mol Med 2006;8:1–11.[Medline]
15. Brinkman DM, de Kleer IM, ten Cate R, van Rossum MA, Bekkering WP, Fasth A, et al.. Autologous stem cell transplantation in children with severe progressive systemic or polyarticular juvenile idiopathic arthritis: long-term follow-up of a prospective clinical trial. Arthritis Rheum 2007;56:2410–21.[CrossRef][Medline]
16. Kimmig S, Przybylski GK, Schmidt CA, Laurisch K, Mowes B, Radbruch A, et al.. Two subsets of naive T helper cells with distinct T cell receptor excision circle content in human adult peripheral blood. J Exp Med 2002;195:789–94.[Abstract/Free Full Text]
17. Douek DC, McFarland RD, Keiser PH, Gage EA, Massey JM, Haynes BF, et al.. Changes in thymic function with age and during the treatment of HIV infection. Nature 1998;396:690–5.[CrossRef][Medline]
18. Ribeiro RM, Perelson AS. Determining thymic output quantitatively: using models to interpret experimental T-cell receptor excision circle (TREC) data. Immunol Rev 2007;216:21–34.[Medline]
19. Lorenzi AR, Patterson AM, Pratt A, Jefferson M, Chapman CE, Ponchel F, et al.. Determination of thymic function directly from peripheral blood: a validated modification of an established method. J Immunol Methods 2008;339:185–94.[CrossRef][Medline]
20. Dion ML, Poulin JF, Bordi R, Sylvestre M, Corsini R, Kettaf N, et al.. HIV infection rapidly induces and maintains a substantial suppression of thymocyte proliferation. Immunity 2004;21:757–68.[CrossRef][Medline]
21. Steinmann GG, Klaus B, Muller-Hermelink HK. The involution of the ageing human thymic epithelium is independent of puberty. A morphometric study. Scand J Immunol 1985;22:563–75.[CrossRef][Medline]
22. Pido-Lopez J, Imami N, Aspinall R. Both age and gender affect thymic output: more recent thymic migrants in females than males as they age. Clin Exp Immunol 2001;125:409–13.[CrossRef][Medline]
23. Kong FK, Chen CL, Cooper MD. Reversible disruption of thymic function by steroid treatment. J Immunol 2002;168:6500–5.[Abstract/Free Full Text]
24. Milicevic NM, Milicevic Z. Cyclosporin A-induced changes of the thymic microenvironment. A review of morphological studies. Histol Histopathol 1998;13:1183–96.[Medline]
25. Prakash, Gupta V, Singh SM, Singh MP, Singh G. Effect of intrauterine exposure of murine fetus to cyclophosphamide on development of thymus. Immunopharmacol Immunotoxicol 2007;29:17–30.[CrossRef][Medline]
26. Livak F. Evolutionarily conserved pattern of gene segment usage within the mammalian TCRbeta locus. Immunogenetics 2003;55:307–14.[CrossRef][Medline]
27. Ruprecht CR, Gattorno M, Ferlito F, Gregorio A, Martini A, Lanzavecchia A, et al.. Coexpression of CD25 and CD27 identifies FoxP3+ regulatory T cells in inflamed synovia. J Exp Med 2005;201:1793–803.[Abstract/Free Full Text]
28. Aspinall R, Andrew D. Gender-related differences in the rates of age associated thymic atrophy. Dev Immunol 2001;8:95–106.[CrossRef][Medline]
29. Zhang L, Lewin SR, Markowitz M, Lin HH, Skulsky E, Karanicolas R, et al.. Measuring recent thymic emigrants in blood of normal and HIV-1-infected individuals before and after effective therapy. J Exp Med 1999;190:725–32.[Abstract/Free Full Text]
30. Madhok AB, Chandrasekran A, Parnell V, Gandhi M, Chowdhury D, Pahwa S. Levels of recent thymic emigrant cells decrease in children undergoing partial thymectomy during cardiac surgery. Clin Diagn Lab Immunol 2005;12:563–5.[Medline]
31. Foster HE, Eltringham MS, Kay LJ, Friswell M, Abinun M, Myers A. Delay in access to appropriate care for children presenting with musculoskeletal symptoms and ultimately diagnosed with juvenile idiopathic arthritis. Arthritis Rheum 2007;57:921–7.[CrossRef][Medline]
32. Junge S, Kloeckener-Gruissem B, Zufferey R, Keisker A, Salgo B, Fauchere JC, et al.. Correlation between recent thymic emigrants and CD31(+) (PECAM-1) CD4(+) T cells in normal individuals during aging and in lymphopenic children. Eur J Immunol 2007;37:3279–80.
33. Bofill M, Martinez-Picado J, Ruiz-Hernandez R, Cabrera C, Marfil S, Erkizia I, et al.. Naive CD4(+) T cells and recent thymic emigrant levels in treated individuals with HIV: clinical relevance. AIDS Res Hum Retroviruses 2006;22:893–6.[CrossRef][Medline]
34. Muraro PA, Douek DC, Packer A, Chung K, Guenaga FJ, Cassiani-Ingoni R, et al.. Thymic output generates a new and diverse TCR repertoire after autologous stem cell transplantation in multiple sclerosis patients. J Exp Med 2005;201:805–16.[Abstract/Free Full Text]
35. Nickel P, Kreutzer S, Bold G, Friebe A, Schmolke K, Meisel C, et al.. CD31+ naive Th cells are stable during six months following kidney transplantation: implications for post-transplant thymic function. Am J Transplant 2005;5:1764–71.[CrossRef][Medline]
36. Kilpatrick RD, Rickabaugh T, Hultin LE, Hultin P, Hausner MA, Detels R, et al.. Homeostasis of the naive CD4+ T cell compartment during aging. J Immunol 2008;180:1499–507.[Abstract/Free Full Text]
37. Ponchel F, Morgan AW, Bingham SJ, Quinn M, Buch M, Verburg RJ, et al.. Dysregulated lymphocyte proliferation and differentiation in patients with rheumatoid arthritis. Blood 2002;100:4550–6.[Abstract/Free Full Text]
38. Small TN, Papadopoulos EB, Boulad F, Black P, Castro-Malaspina H, Childs BH, et al.. Comparison of immune reconstitution after unrelated and related T-cell-depleted bone marrow transplantation: effect of patient age and donor leukocyte infusions. Blood 1999;93:467–80.[Abstract/Free Full Text]
39. Mackall CL, Bare CV, Granger LA, Sharrow SO, Titus JA, Gress RE. Thymic-independent T cell regeneration occurs via antigen-driven expansion of peripheral T cells resulting in a repertoire that is limited in diversity and prone to skewing. J Immunol 1996;156:4609–16.[Abstract]
40. Eyrich M, Wollny G, Tzaribaschev N, Dietz K, Brugger D, Bader P, et al.. Onset of thymic recovery and plateau of thymic output are differentially regulated after stem cell transplantation in children. Biol Blood Marrow Transplant 2005;11:194–205.[CrossRef][Medline]
41. Bingham S, Veale D, Fearon U, Isaacs JD, Morgan G, Emery P, et al.. High-dose cyclophosphamide with stem cell rescue for severe rheumatoid arthritis: short-term efficacy correlates with reduction of macroscopic and histologic synovitis. Arthritis Rheum 2002;46:837–9.[CrossRef][Medline]
42. de Kleer I, Vastert B, Klein M, Teklenburg G, Arkesteijn G, Yung GP, et al.. Autologous stem cell transplantation for autoimmunity induces immunologic self-tolerance by reprogramming autoreactive T cells and restoring the CD4+CD25+ immune regulatory network. Blood 2006;107:1696–702.[Abstract/Free Full Text]
43. Goldberg GL, Zakrzewski JL, Perales MA, van den Brink MR. Clinical strategies to enhance T cell reconstitution. Semin Immunol 2007;19:289–96.[CrossRef][Medline]
44. van den Brink MR, Alpdogan O, Boyd RL. Strategies to enhance T-cell reconstitution in immunocompromised patients. Nat Rev Immunol 2004;4:856–67.[CrossRef][Medline]
45. Naylor K, Li G, Vallejo AN, Lee WW, Koetz K, Bryl E, et al.. The influence of age on T cell generation and TCR diversity. J Immunol 2005;174:7446–52.[Abstract/Free Full Text]
46. Nikolich-Zugich J. T cell aging: naive but not young. J Exp Med 2005;201:837–40.[Abstract/Free Full Text]
47. Sarzotti M, Patel DD, Li X, Ozaki DA, Cao S, Langdon S, et al.. T cell repertoire development in humans with SCID after nonablative allogeneic marrow transplantation. J Immunol 2003;170:2711–8.[Abstract/Free Full Text]
48. Haas J, Fritzsching B, Trubswetter P, Korporal M, Milkova L, Fritz B, et al.. Prevalence of newly generated naive regulatory T cells (treg) is critical for treg suppressive function and determines treg dysfunction in multiple sclerosis. J Immunol 2007;179:1322–30.[Abstract/Free Full Text]
49. Lawson CA, Brown AK, Bejarano V, Douglas SH, Burgoyne CH, Greenstein AS, et al.. Early rheumatoid arthritis is associated with a deficit in the CD4+CD25high regulatory T cell population in peripheral blood. Rheumatology (Oxford) 2006;45:1210–7.[CrossRef][Medline]
50. Hori S, Nomura T, Sakaguchi S. Control of regulatory T cell development by the transcription factor Foxp3. Science 2003;299:1057–61.[Abstract/Free Full Text]

CiteULike    Complore    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this?

This article has been cited by other articles:

• OLIVITO, B., SIMONINI, G., CIULLINI, S., MORIONDO, M., BETTI, L., GAMBINERI, E., CANTARINI, L., DE MARTINO, M., AZZARI, C., CIMAZ, R. (2009). Th17 Transcription Factor RORC2 Is Inversely Correlated with FOXP3 Expression in the Joints of Children with Juvenile Idiopathic Arthritis. The Journal of Rheumatology 36: 2017-2024 [Abstract] [Full Text]